Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.167716 |
Chromosome: | chromosome 8 |
Location: | 4415861 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g382100 | (1 of 4) PTHR11584//PTHR11584:SF377 - SERINE/THREONINE PROTEIN KINASE // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTAGGGTCGTCGTAAACTGGCTTGCACTC |
Internal bar code: | ATTGAGTCCAATGGTGAAGACA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 633 |
LEAP-Seq percent confirming: | 99.33 |
LEAP-Seq n confirming: | 2817 |
LEAP-Seq n nonconfirming: | 19 |
LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACCGAAGTCAACAGAGCAA |
Suggested primer 2: | CTGACGTCAAGCAGCGTCT |