| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.167745 |
| Chromosome: | chromosome 16 |
| Location: | 2375902 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g660000 | CMT1A,CPLD63 | (1 of 2) PTHR12608:SF7 - GDT1-LIKE PROTEIN 2, CHLOROPLASTIC; Mn transport into chloroplast | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCGCGCTACGAGCATGCCACGCCAACG |
| Internal bar code: | AGGGCGGGCCCGGACCTGGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 0.947867 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 627 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AATAAGCTGGAGCTGTGCGT |
| Suggested primer 2: | GGCGGTGTTGTAGATCTGGT |