Insertion junction: LMJ.RY0402.167790_1


Insertion cassette:CIB1
Side of cassette:5'
Confidence (%):73
Locus systemic id Locus common name Defline Orientation Feature
Cre06.g311700 antisense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):CGACATACAGTGCCCTCCACGGGTGCGACA

Confirmation - LEAP-Seq

LEAP-Seq distance:302
LEAP-Seq percent confirming:99.7262
LEAP-Seq n confirming:1457
LEAP-Seq n nonconfirming:4
LEAP-Seq n unique pos:1

Suggested primers for confirmation by PCR