| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.167868 |
| Chromosome: | chromosome 5 |
| Location: | 3247294 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g240100 | EXN9 | 3' repair exonuclease; (1 of 3) 3.1.11.2 - Exodeoxyribonuclease III / Exonuclease III | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCGCCGACCAGCGCGGCAGTGGACGCGG |
| Internal bar code: | GGTCCGATTAGAAGGGCCTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 91 |
| LEAP-Seq percent confirming: | 41.6667 |
| LEAP-Seq n confirming: | 20 |
| LEAP-Seq n nonconfirming: | 28 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTGTGTGTGTGTGTGTGT |
| Suggested primer 2: | ACACACACACACACACCACG |