Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.167876 |
Chromosome: | chromosome_9 |
Location: | 3669181 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre09.g390615 | FAP12 | Triacylglycerol lipase and Flagellar Associated Protein | antisense | intron |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | CGACAAGGAGGAGGTGGAGGACCCCAAGGC |
Internal bar code: | TGTGATTCCGCACAGAAGGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1051 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ATCATGTAGCTGCCCTTGCT |
Suggested primer 2: | GAGCCTGAGTACGCCAAGTC |