| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.167887 |
| Chromosome: | chromosome 3 |
| Location: | 4047795 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172400 | (1 of 100) IPR001810 - F-box domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGAACTGCGTGTCCTCCAAGTCCGCCTC |
| Internal bar code: | CTGCGATCGCAATCCTCTGTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1210 |
| LEAP-Seq percent confirming: | 90.2128 |
| LEAP-Seq n confirming: | 424 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCGCTCCTCCTAAGAAAGT |
| Suggested primer 2: | TCCAGTTTGTCGTTCGTGAG |