| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.167897 |
| Chromosome: | chromosome 11 |
| Location: | 3766968 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g483100 | (1 of 1) IPR019931 - LPXTG cell wall anchor domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAACGTAGCACCGCCGCCGGCAGTGGTG |
| Internal bar code: | AATGGTTAGGGGAGGGGACGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 847 |
| LEAP-Seq percent confirming: | 77.1883 |
| LEAP-Seq n confirming: | 1164 |
| LEAP-Seq n nonconfirming: | 344 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAACAGCTCCAACTCCTCC |
| Suggested primer 2: | GTGAAACTGTTGATGGGGCT |