| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.167917 |
| Chromosome: | chromosome 4 |
| Location: | 162590 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g216902 | ODA16,DAW1,WDR69 | (1 of 1) PTHR22847//PTHR22847:SF464 - WD40 REPEAT PROTEIN // DYNEIN ASSEMBLY FACTOR WITH WDR REPEAT DOMAINS 1; Outer Arm Dynein-IFT adaptor | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAGAACCGGCGGCCAGCGCTGCGTCAGC |
| Internal bar code: | GTGCCTGCTGAGAGGGGGGTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 286 |
| LEAP-Seq percent confirming: | 89.0751 |
| LEAP-Seq n confirming: | 1541 |
| LEAP-Seq n nonconfirming: | 189 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAAAAACACAAAGACGGCCC |
| Suggested primer 2: | CACTAACCCCAACTCTCCCA |