| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.167920 |
| Chromosome: | chromosome 3 |
| Location: | 8497544 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g200655 | DEG4 | (1 of 1) 3.2.1.55 - Non-reducing end alpha-L-arabinofuranosidase / Arabinosidase; DegP protease and Glycoside hydrolase family 3 protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCACTGGAAGGCAGCTGAGCCGCATGGAT |
| Internal bar code: | TAGGGGTCAAATCGGCCGTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 889 |
| LEAP-Seq percent confirming: | 99.6866 |
| LEAP-Seq n confirming: | 39448 |
| LEAP-Seq n nonconfirming: | 124 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCATGCGTAAGTGTTCCAT |
| Suggested primer 2: | AGTCGGAGGAAGAGGAGGAG |