Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.168138 |
Chromosome: | chromosome 7 |
Location: | 457034 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g315500 | (1 of 8) IPR001810//IPR006553 - F-box domain // Leucine-rich repeat, cysteine-containing subtype | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGTACGGGCGGTGCGCGGTCGCGGCAGTG |
Internal bar code: | ATAGCAGTATCTTGGAGTGAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 404 |
LEAP-Seq percent confirming: | 98.3906 |
LEAP-Seq n confirming: | 917 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACACACACACACACACGC |
Suggested primer 2: | CCTGGTGAACCTGTTCCTGT |