| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.168215 |
| Chromosome: | chromosome 10 |
| Location: | 2065044 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g433050 | ARCS,DRP5B,ARC5,DRP8 | Putative dynamin GTPase involved in plastid division; (1 of 1) PTHR11566:SF78 - DYNAMIN-LIKE PROTEIN ARC5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTAGGAGCGGGAGCTCTCGGGGAAGGACC |
| Internal bar code: | TAGATCGGTCCTGAGGAATTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 188 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 85 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCTAGCAGCCTAGCACCT |
| Suggested primer 2: | GCTGTCCTCAACCTGGAGAG |