Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.168267 |
Chromosome: | chromosome 14 |
Location: | 2987849 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g627950 | SRD2 | 3-oxo-5-alpha-steroid 4-dehydrogenase family protein; (1 of 1) 1.3.1.22 - 3-oxo-5-alpha-steroid 4-dehydrogenase (NADP(+)) / Cholestenone 5-alpha-reductase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGCGCGCGTACCCCGGCTTGCCCCTCT |
Internal bar code: | GGGGTGCAAGTGGATACCGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 798 |
LEAP-Seq percent confirming: | 98.4568 |
LEAP-Seq n confirming: | 2552 |
LEAP-Seq n nonconfirming: | 40 |
LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTAGCAGGTGCACGACAT |
Suggested primer 2: | TGTGTGTGTGTTTGACGGTG |