| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.168278 |
| Chromosome: | chromosome 3 |
| Location: | 8135807 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g200700 | FAP166 | (1 of 79) IPR011992 - EF-hand domain pair; Flagellar Associated Protein 166 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTACGTTGATGGGGACGATGCGGTAGTGGC |
| Internal bar code: | GGTGACCATTGAGGGAAAATCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1030 |
| LEAP-Seq percent confirming: | 92.9651 |
| LEAP-Seq n confirming: | 7810 |
| LEAP-Seq n nonconfirming: | 591 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGGCTACGAGGTCACTC |
| Suggested primer 2: | TGACGCCTTTGTGTCTATGC |