| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.168370 |
| Chromosome: | chromosome 10 |
| Location: | 2662230 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g437800 | (1 of 3) IPR000104//IPR001054//IPR006059//IPR029787 - Antifreeze protein, type I // Adenylyl cyclase class-3/4/guanylyl cyclase // Solute-binding family 1 // Nucleotide cyclase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTGTGTGGGGGGGGTGTCAGGTATGCA |
| Internal bar code: | CTCTTGAGTCTCGGTCGGGCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 336 |
| LEAP-Seq percent confirming: | 98.3457 |
| LEAP-Seq n confirming: | 2378 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGTGCATGAGAAGGCACAA |
| Suggested primer 2: | AGTTGAAGTGGTCAGGGTGG |