| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.168384 |
| Chromosome: | chromosome 8 |
| Location: | 4274750 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g381050 | CEP8 | Cysteine endopeptidase; (1 of 3) 3.4.22.67 - Zingipain / Zingibain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGCCCTCCCCTCCATCTTTCTTGTAGGT |
| Internal bar code: | CAAAAAGGGGCCGTGGGCTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1026 |
| LEAP-Seq percent confirming: | 99.7124 |
| LEAP-Seq n confirming: | 2080 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTACTCCGTGGCCTGGAC |
| Suggested primer 2: | TGGGGGCTCAAAATACTGAC |