| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.168427 |
| Chromosome: | chromosome 7 |
| Location: | 3232528 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g334100 | GNOM | (1 of 1) K18443 - golgi-specific brefeldin A-resistance guanine nucleotide exchange factor 1 (GBF1); SEC7/BIG-type ARF-GEF | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCGTGCGTTCCCGCACTCAAGCGATGCAT |
| Internal bar code: | GCGTAAGGGGAGAGGTTTACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 165 |
| LEAP-Seq percent confirming: | 96.71 |
| LEAP-Seq n confirming: | 1117 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCTGGCGTTCTTCAGTCT |
| Suggested primer 2: | TTAGTGCTGCATTGCTCACC |