| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.168443 |
| Chromosome: | chromosome 12 |
| Location: | 9273548 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g541300 | KATL4 | katanin like protein 4, similar to the catalytic subunit; (1 of 9) 3.6.4.3 - Microtubule-severing ATPase / Katanin | gene_edge/mRNA_edge/5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGATGGGTGAGCGGGCTTTCGATTCGGG |
| Internal bar code: | GACTGGCGAGTCGGAGTCAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 490 |
| LEAP-Seq percent confirming: | 99.3879 |
| LEAP-Seq n confirming: | 1299 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCTCCCTGTAAACCTGTG |
| Suggested primer 2: | AACGTCCAGGTCCTTGTGAG |