Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.168488 |
Chromosome: | chromosome 5 |
Location: | 393694 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g232900 | (1 of 4) PF02181 - Formin Homology 2 Domain (FH2) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGACTGTTGACCACTTGACCGGATGCCGC |
Internal bar code: | GGGTGGACGTAAATCCACCCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 466 |
LEAP-Seq percent confirming: | 99.7823 |
LEAP-Seq n confirming: | 1375 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTGTGTGTGTGTGGCAGA |
Suggested primer 2: | CATAATGCGTATGTGCGTCC |