| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.168514 |
| Chromosome: | chromosome 1 |
| Location: | 4603826 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g031600 | (1 of 2) PF05915 - Eukaryotic protein of unknown function (DUF872) (DUF872) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAACCCTTGGCCACCAGCCATCAGGGTATG |
| Internal bar code: | AGGTAGTCCGTACGCGGAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1029 |
| LEAP-Seq percent confirming: | 83.1027 |
| LEAP-Seq n confirming: | 2282 |
| LEAP-Seq n nonconfirming: | 464 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTAGCAAGAAGGGACAAG |
| Suggested primer 2: | GTAAAAGGTCGTCGGCACAT |