| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.168518 |
| Chromosome: | chromosome 1 |
| Location: | 4117006 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g027050 | (1 of 3) PF11527 - The ARF-like 2 binding protein BART (ARL2_Bind_BART) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAATGTTTACTTGCGCAGGCAAGCAGGAGA |
| Internal bar code: | TTGAATTCTTTAATTTTCTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1067 |
| LEAP-Seq percent confirming: | 98.9302 |
| LEAP-Seq n confirming: | 3514 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCAGTATCCGAAACCAAG |
| Suggested primer 2: | TGCATATGGCTGTCATCGTT |