| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.168610 |
| Chromosome: | chromosome 10 |
| Location: | 5970170 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g462350 | (1 of 40) PTHR23257//PTHR23257:SF513 - SERINE-THREONINE PROTEIN KINASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACCAAAGTCACTCTCGGCCCGCTTTCTC |
| Internal bar code: | GTGGCTCGGCCCTCGAGATTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 586 |
| LEAP-Seq percent confirming: | 98.373 |
| LEAP-Seq n confirming: | 22009 |
| LEAP-Seq n nonconfirming: | 364 |
| LEAP-Seq n unique pos: | 91 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AACAGGCACATAGCCAAACC |
| Suggested primer 2: | CAAATCCCGCCCACTAAGTA |