| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.168684 |
| Chromosome: | chromosome 13 |
| Location: | 3884800 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g590300 | URK2,CMPK1 | (1 of 1) PTHR10285:SF76 - URIDINE KINASE; Uridine kinase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAAATAGGGGCACGCTCGCTGATCTTTGC |
| Internal bar code: | TGGTCTGCAGCTACGAGTATCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 781 |
| LEAP-Seq percent confirming: | 99.8159 |
| LEAP-Seq n confirming: | 3254 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGATGTTGCAGACGGTACT |
| Suggested primer 2: | GCCAGCTGTAGCTGCTCTTT |