| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.168702 |
| Chromosome: | chromosome 1 |
| Location: | 3851817 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g024900 | (1 of 1) PTHR10501:SF19 - RNA-BINDING REGION RNP-1 DOMAIN-CONTAINING PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCACGTTTGGACGTCACTGTTGTTGCGA |
| Internal bar code: | AAACCCGCACCACTGGGGACGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1134 |
| LEAP-Seq percent confirming: | 96.7875 |
| LEAP-Seq n confirming: | 4911 |
| LEAP-Seq n nonconfirming: | 163 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACCTGGCGTTGGTATGG |
| Suggested primer 2: | GTCGCCACAAACAACAGCTA |