| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.168741 |
| Chromosome: | chromosome 2 |
| Location: | 5911873 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g111550 | (1 of 1) IPR000104//IPR000719//IPR001229//IPR002290//IPR011009//IPR020635 - Antifreeze protein, type I // Protein kinase domain // Jacalin-like lectin domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAATGTGCCTTGCAGCACCACGCCGATGG |
| Internal bar code: | CCTCCATGCTGGCCGGTACGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 377 |
| LEAP-Seq percent confirming: | 94.707 |
| LEAP-Seq n confirming: | 2004 |
| LEAP-Seq n nonconfirming: | 112 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTATCCAGCTAGTGGCGG |
| Suggested primer 2: | GCTGATGGTCTTCGTTCCAT |