| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.168804 |
| Chromosome: | chromosome 1 |
| Location: | 6872823 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g049650 | (1 of 32) 3.6.4.4 - Plus-end-directed kinesin ATPase / Kinesin | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCATCGTCGCATTCTGTTCTGGAAGAAGGC |
| Internal bar code: | GGCCTGTTCTATCCCGCGTAGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 444 |
| LEAP-Seq percent confirming: | 0.146424 |
| LEAP-Seq n confirming: | 94 |
| LEAP-Seq n nonconfirming: | 64103 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTATGTCGAGGGAGGCAG |
| Suggested primer 2: | GCCGACCTGAGTCTTCTACG |