Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.168864 |
Chromosome: | chromosome 17 |
Location: | 2975153 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g720250 | LHCB4,CP29 | Chlorophyll a/b binding protein of photosystem II | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGCAGTTGGCAACTTATCATACACAACA |
Internal bar code: | CTTCAGCGGGATTTGGCCGGCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 547 |
LEAP-Seq percent confirming: | 98.9376 |
LEAP-Seq n confirming: | 1490 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGTGTTCTTGTCCAGAGCG |
Suggested primer 2: | TCGATGTAATCTCGCTGACG |