Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.168902 |
Chromosome: | chromosome 13 |
Location: | 4113348 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g591550 | SRR20 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 1) PTHR19331//PTHR19331:SF279 - LYSYL OXIDASE-RELATED // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAAACCCCAAGGCTTCACGGTGCGTGCG |
Internal bar code: | GCCCTCATAGGTCGTGGGTCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 970 |
LEAP-Seq percent confirming: | 97.5998 |
LEAP-Seq n confirming: | 3375 |
LEAP-Seq n nonconfirming: | 83 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGGATAATATTAACGGCGG |
Suggested primer 2: | CTAGGTCTTCCGCAACAAGC |