| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.168962 |
| Chromosome: | chromosome 13 |
| Location: | 3019431 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g584400 | FAP189 | Coiled-Coil Flagellar Associated Protein 189; (1 of 1) PTHR32083//PTHR32083:SF31 - FAMILY NOT NAMED // COILED-COIL DOMAIN-CONTAINING PROTEIN 147 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTGCGCACGCATTCGTCTGCGCTTGCGT |
| Internal bar code: | GTGAAAGCCGCTGCGCGTGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 717 |
| LEAP-Seq percent confirming: | 99.8837 |
| LEAP-Seq n confirming: | 859 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACCACATCATCAACGAGG |
| Suggested primer 2: | AGATACACCTGCAACCTGCC |