Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.169033 |
Chromosome: | chromosome 12 |
Location: | 103627 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g484150 | (1 of 1) K15501 - serine/threonine-protein phosphatase 6 regulatory subunit 3 (PPP6R3, SAPS3) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTTGCCCACACAGTTCCTGGAGTACACGT |
Internal bar code: | AATGACTCCAGGACGGCCGTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1148 |
LEAP-Seq percent confirming: | 99.3627 |
LEAP-Seq n confirming: | 4054 |
LEAP-Seq n nonconfirming: | 26 |
LEAP-Seq n unique pos: | 32 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGAGGCAGGTGTAGCAGGA |
Suggested primer 2: | CAGCTCTGGACTAGGGCATC |