| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.169043 |
| Chromosome: | chromosome 12 |
| Location: | 8700913 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g546200 | RBL5 | Rhomboid-like protein; (1 of 4) PTHR22936//PTHR22936:SF32 - RHOMBOID-RELATED // SUBFAMILY NOT NAMED | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGACTGCACGCCCGAGCGCGCTGCGGCC |
| Internal bar code: | GTCTGCATCGCCAGCCAGCCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 754 |
| LEAP-Seq percent confirming: | 93.5034 |
| LEAP-Seq n confirming: | 1943 |
| LEAP-Seq n nonconfirming: | 135 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGTCCACCACAGCCTTTTC |
| Suggested primer 2: | TTCCGGTCTATGTCCTCCAG |