| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.169046 |
| Chromosome: | chromosome 10 |
| Location: | 2921382 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g440250 | PGM19 | Putative phosphoglycerate mutase; (1 of 1) 3.1.3.80 - 2,3-bisphosphoglycerate 3-phosphatase / 2,3-BPG 3-phosphatase | gene_edge/mRNA_edge/3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAACATCGTCAGCACCCAGTCGCTGCTC |
| Internal bar code: | GTACTATAGCGTCGTGGGTACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 207 |
| LEAP-Seq percent confirming: | 99.6201 |
| LEAP-Seq n confirming: | 5244 |
| LEAP-Seq n nonconfirming: | 20 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAACCCTCCCTGCACGTTA |
| Suggested primer 2: | AACGGCGAGTTGAAAGAAGA |