| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.169056 |
| Chromosome: | chromosome 3 |
| Location: | 5199429 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g182600 | CPL1 | Conserved in the Plant Lineage; (1 of 1) PF08642 - Histone deacetylation protein Rxt3 (Rxt3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCGCAACCATAGCGGGCTCGTCGTGTATA |
| Internal bar code: | ATCGAATGGAACCACGGTTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1029 |
| LEAP-Seq percent confirming: | 99.7096 |
| LEAP-Seq n confirming: | 3777 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTTACATGCGCTTGACTG |
| Suggested primer 2: | GGCATCATGCTAATCCCTGT |