| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.169069 |
| Chromosome: | chromosome 2 |
| Location: | 1039099 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g080600 | BIP2 | (1 of 2) K09490 - heat shock 70kDa protein 5 (HSPA5, BIP); Endoplasmic reticulum associated Hsp70 protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGCATCGTTAAAGTACGCGGGCACGGTG |
| Internal bar code: | ATGAAGGGTAAATGTCCTGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1391 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 99 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTCAACGGTCAAGTTGGTT |
| Suggested primer 2: | AGCCGAAGCTTGTCGATTTA |