| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.169103 |
| Chromosome: | chromosome 12 |
| Location: | 3432937 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g496450 | RRP4 | (1 of 1) K03679 - exosome complex component RRP4 (RRP4, EXOSC2); RNA binding component of exosome complex | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGTGCAGTCACACACCCCAGCGCCCTCA |
| Internal bar code: | CGTGTCGGCTATCCAGGGACCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 426 |
| LEAP-Seq percent confirming: | 97.2118 |
| LEAP-Seq n confirming: | 1290 |
| LEAP-Seq n nonconfirming: | 37 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATACAGCCGCCCTAGGACTT |
| Suggested primer 2: | GATGCAGCTGGAGGTGGTAT |