Insertion junction: LMJ.RY0402.169169_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.169169
Chromosome:chromosome_8
Location:4151435
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TGCTTGGCGGCGGCGGGACAGGCGGCGGGA
Internal bar code:GCTATAGAGATACATTTTCCAA

Confirmation - LEAP-Seq

LEAP-Seq distance:970
LEAP-Seq percent confirming:99.8086
LEAP-Seq n confirming:2607
LEAP-Seq n nonconfirming:5
LEAP-Seq n unique pos:4

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCCTGTGCTTTCCTGCT
Suggested primer 2:TTGTAACGACAGCTTGCGAC