Insertion junction: LMJ.RY0402.169169_2

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.169169
Chromosome:chromosome_8
Location:4151437
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre08.g379900 antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GCCGTACGCTCGTCACCGTACGACAGAGAT
Internal bar code:GGCTCCGCGTGTGGCAAAACGC

Confirmation - LEAP-Seq

LEAP-Seq distance:1048
LEAP-Seq percent confirming:96.1265
LEAP-Seq n confirming:3921
LEAP-Seq n nonconfirming:158
LEAP-Seq n unique pos:41

Suggested primers for confirmation by PCR

Suggested primer 1:TTTTCCTGTGCTTTCCTGCT
Suggested primer 2:TTGTAACGACAGCTTGCGAC