| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.169187 |
| Chromosome: | chromosome 2 |
| Location: | 3558336 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095130 | FAS7,FLA2 | FAS1 domain containing protein;; (1 of 21) PF02469 - Fasciclin domain (Fasciclin) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCCTCCCTGTCAATGTGGTAAGCAATTAA |
| Internal bar code: | TTTATAGGCTCCTCGTTAGAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 360 |
| LEAP-Seq percent confirming: | 99.6016 |
| LEAP-Seq n confirming: | 1250 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACAGACTGCGCACTTACG |
| Suggested primer 2: | GCTAGGTGTTCAGAGGTCGC |