| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.169350 |
| Chromosome: | chromosome 9 |
| Location: | 3516832 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g389801 | (1 of 1) PF08854 - Domain of unknown function (DUF1824) (DUF1824) | 3'UTR|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTTTGCGCGTCCTCTTTCCCTAGGGAAC |
| Internal bar code: | ATACTCTCTATGACTTGGGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1007 |
| LEAP-Seq percent confirming: | 99.7162 |
| LEAP-Seq n confirming: | 1054 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGCGGTGTGTACCTAAAGT |
| Suggested primer 2: | GGGCAAGTGCAGAGTTAAGC |