| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.169384 |
| Chromosome: | chromosome 16 |
| Location: | 5360215 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g681750 | FAP381 | Flagellar Associated Protein 381; (1 of 5) K01537 - Ca2+-transporting ATPase (E3.6.3.8) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGTCCGCCGTCAAGCTGTCCCCTCATCC |
| Internal bar code: | GTCACTTTTGTATAGATGTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 77 |
| LEAP-Seq percent confirming: | 96.2963 |
| LEAP-Seq n confirming: | 78 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGCCCTCTACAAGGTGAG |
| Suggested primer 2: | AGGGGAGATAGACAGCAGCA |