Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.169407 |
Chromosome: | chromosome 16 |
Location: | 4634801 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g687600 | (1 of 7) IPR000104//IPR020683 - Antifreeze protein, type I // Ankyrin repeat-containing domain | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGCAATAGCCAATTAGACGGGGTTCGG |
Internal bar code: | ACGGCCTCGGGTGCATGGGCTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 915 |
LEAP-Seq percent confirming: | 97.105 |
LEAP-Seq n confirming: | 5199 |
LEAP-Seq n nonconfirming: | 155 |
LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCCTTCTTCCACAGCGAGT |
Suggested primer 2: | ATGTAGGCCTGCCAAATCAC |