| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.169477 |
| Chromosome: | chromosome 6 |
| Location: | 5643823 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g286050 | MCP20 | Mitochondrial substrate carrier protein; (1 of 1) K15118 - solute carrier family 25, member 38 (SLC25A38) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGAAGAAACCAGAGCTACCCTTGTAAA |
| Internal bar code: | GCATCGGGGGACACGGGTGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 683 |
| LEAP-Seq percent confirming: | 98.5591 |
| LEAP-Seq n confirming: | 684 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCGTTATGGCGTGATGTG |
| Suggested primer 2: | TGAGACCTGCATCGACTGAC |