| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.169494 |
| Chromosome: | chromosome 16 |
| Location: | 487939 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g693204 | FAP348 | Flagellar Associated Protein 348; (1 of 1) IPR001660//IPR002048//IPR013761 - Sterile alpha motif domain // EF-hand domain // Sterile alpha motif/pointed domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCTGGACGAGGCGGCGGCGGCGGCGCCC |
| Internal bar code: | TATACTAAGCTATGGCACGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 578 |
| LEAP-Seq percent confirming: | 59.6026 |
| LEAP-Seq n confirming: | 900 |
| LEAP-Seq n nonconfirming: | 610 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGGACGACTACGACGATGA |
| Suggested primer 2: | TCCAATAATGCTAGGCGGAC |