Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.169557 |
Chromosome: | chromosome 4 |
Location: | 2408032 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g221250 | (1 of 1) PF11378 - Protein of unknown function (DUF3181) (DUF3181) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGCAACAAGACGCCGTACGAGGAGTTC |
Internal bar code: | GGTCACCCGGTGTAATACACTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 568 |
LEAP-Seq percent confirming: | 89.4921 |
LEAP-Seq n confirming: | 7171 |
LEAP-Seq n nonconfirming: | 842 |
LEAP-Seq n unique pos: | 51 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGAGGGCTACCCACTACCT |
Suggested primer 2: | CAAGCGTCTCGTGTTCGTTA |