| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.169675 |
| Chromosome: | chromosome 1 |
| Location: | 3518003 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g022500 | MME5 | NADP-dependent malic enzyme 5; (1 of 5) 1.1.1.40 - Malate dehydrogenase (oxaloacetate-decarboxylating) (NADP(+)) / Pyruvic-malic carboxylase | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGCCTCAACTTATCCCCCATCCTTCAT |
| Internal bar code: | TGTCAGTCCCGATATAGATGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 547 |
| LEAP-Seq percent confirming: | 99.879 |
| LEAP-Seq n confirming: | 3303 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGGCGTGCTAAATTCTAAG |
| Suggested primer 2: | GAGTTCATGGGAATCGCTGT |