Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.169756 |
Chromosome: | chromosome 11 |
Location: | 241097 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467555 | (1 of 1) PF00023//PF13857 - Ankyrin repeat (Ank) // Ankyrin repeats (many copies) (Ank_5) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCCTATGCCCGCCGCCAACGCACCCAC |
Internal bar code: | GCCGGGGAGGGCATGAAAGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 463 |
LEAP-Seq percent confirming: | 65.7994 |
LEAP-Seq n confirming: | 16615 |
LEAP-Seq n nonconfirming: | 8636 |
LEAP-Seq n unique pos: | 79 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTGTATGGATAGGAGGCGT |
Suggested primer 2: | TTCTGTCACGCCTGTCTGTC |