Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.169834 |
Chromosome: | chromosome 5 |
Location: | 1001820 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g246550 | LAO3 | (1 of 3) PTHR10742//PTHR10742:SF288 - AMINE OXIDASE // SUBFAMILY NOT NAMED; L-amino-acid oxidase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGCCGATCGACACGTACCGTGCCAGGC |
Internal bar code: | GACTTCCATAAGCCGCTAGATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 712 |
LEAP-Seq percent confirming: | 90.0128 |
LEAP-Seq n confirming: | 703 |
LEAP-Seq n nonconfirming: | 78 |
LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAATTCATGACTGCCCACA |
Suggested primer 2: | TGCGCAAACCCTCTCTATCT |