Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.169837 |
Chromosome: | chromosome 2 |
Location: | 2522039 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g092350 | CYP51G1,CYP6 | (1 of 1) 1.14.13.70 - Sterol 14-alpha-demethylase / Obtusufoliol 14-demethylase; Cytochrome P450, CYP51 superfamily | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCATGTTGGTCTCCTCGACCTCCTTACAGG |
Internal bar code: | GGCTCAAGCGCACGCAGAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 154 |
LEAP-Seq percent confirming: | 95.0 |
LEAP-Seq n confirming: | 38 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTCAGCGAACTGTTAGCCC |
Suggested primer 2: | TAACGCTTTGAATGCTGTGC |