| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.169872 |
| Chromosome: | chromosome 3 |
| Location: | 362338 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g144827 | MIA40 | Mitochondrial intermembrane space protein 40; (1 of 1) IPR012891//IPR015360 - GCK // XPC-binding domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGACGTGTTGGCCGCAGCCGACCGAGCGA |
| Internal bar code: | AGCTCCATCTCCGGCCCGGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 802 |
| LEAP-Seq percent confirming: | 99.194 |
| LEAP-Seq n confirming: | 1723 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGCACTCGTGGATCTGTG |
| Suggested primer 2: | ACTACAAGGACTGCATCCCG |