| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.169967 |
| Chromosome: | chromosome 13 |
| Location: | 3456142 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g587550 | FXL3 | FixL-like PAS domain protein; (1 of 12) 2.7.13.3 - Histidine kinase / Protein kinase (histidine) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCAGCGCCTTGTCTACCTCCGTGACCTT |
| Internal bar code: | CGTGATTGGATTTGGATGTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 374 |
| LEAP-Seq percent confirming: | 99.6584 |
| LEAP-Seq n confirming: | 6126 |
| LEAP-Seq n nonconfirming: | 21 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCATCAAGGCAAGTCACAGC |
| Suggested primer 2: | GTTCACATAGCGGGTGAGGT |