| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.169984 |
| Chromosome: | chromosome 6 |
| Location: | 8527777 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g308000 | FAP331 | (1 of 3) PTHR32215//PTHR32215:SF0 - FAMILY NOT NAMED // WD REPEAT-CONTAINING PROTEIN 65; Flagellar Associated Protein 331 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGACGCTCGGAACTACTGAATTCATCGCG |
| Internal bar code: | AGTCTGAGACGGCAGCGGAAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 494 |
| LEAP-Seq percent confirming: | 99.6295 |
| LEAP-Seq n confirming: | 4571 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGCAGAGTGAAGGTGATA |
| Suggested primer 2: | CGTACAACAATCAACGCCAG |